13-12-2017
Chemistry

contestada

How many grams of oxygen are in 50.00 g of sucrose

Respuesta :

cassidyrharris cassidyrharris

13-12-2017

176g of the total 342g per mole of sucrose is oxygen

Answer Link

Otras preguntas

Which of the following played a part in the development of Hebrew religious ideas? Select all correct answers. A. The Ten Commandments became part of Hebrew cul

Question 5 Reread paragraph 10 of "The Duck and the Smartphone." Which content due in the paragraph can help you figure out the meaning of yoracious? For some d

I need to match the nitrogenous base with its complementary base pair from one strand: ATTGGCCATTGGAATACCAGTCGAGGCCACCGAGGCCTTAC

If two ounces of cheese has 200 calories, how many calories are in 5 ounces of cheese? please help!!

How did Squanto learn to speak English?

Abner operates a small repair business and is in desperate need of a certain type of building material. He obtains the material from a large corporation, but is

Someone with no fixed home?

6/5 divided by *blank* equals six. A. 1/5 B.30 C.1/30 D. 5

Which of the following is a similarity between the inclusive model and the traditional model of diversity? a.Both include aspects of diversity that can be acqui

Suppose that Daniel has a 2.50 L bottle that contains a mixture of O2 , N2 , and CO2 under a total pressure of 5.80 atm. He knows that the mixture contains 0.29