ereanser ereanser

15-01-2021
Biology

contestada

AGTACTACGTTGCTTAGTGCTAGCTTAGCTATA

How many codons are there in this strand, from left to right?

Respuesta :

autumnstoddard84 autumnstoddard84

15-01-2021

Answer: should be 11!

Explanation: every 3 letters = a codon
There are 33 codons, divide it by 3 and get 11! Or you can count by 3’s until the end

Answer Link

Otras preguntas

Why was the Mexican government worried about the number of Americans moving into the region? a. They wanted Spanish to be the main language, and feared Anglo cu

(70 POINTS! )How many gallons of water were in the bucket after 1 second? Explain your thinking. Last question people put two different answers so im trying to

Which of the following favors the solubility of an ionic solid in a liquid solvent? Group of answer choices a large magnitude of the solvation energy of the ion

sour is to mouth as sent is to

Sonia was experimenting with electric charges. She tied two inflated balloons together, held them next to each other, and rubbed both with a piece of wool. What

The following figures are similar. Solve for the missing side length.

the ____ carbon combines with the _____ oxygen to form the ____ carbon dioxide. a. compound; compound; element b. element; compound; mixture c. element; element

what is the solution to the expression -2 - 3 - (-4)

Ming and her sister who is home from college for spring break organized a bake sale to benefit the victims of the fire. Which version of the sentence has correc

When the isotonic saline solution described in part A is connected to an unknown solution via a semipermeable membrane, the unknown solution level drops. Based