cheyyy5 cheyyy5

14-01-2021
Biology

contestada

1-5 For the following DNA sequences, replicate the DNA
1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC

Respuesta :

angelomontoya angelomontoya

14-01-2021

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

Answer Link

Otras preguntas

If the template DNA strand 3' T-G-T-A-C-A-G-A-C-C-A 5’ is at the beginning of a gene, what are the first 3 amino acids that will be joined at the ribosome? (Thi

PLEASE ANSWER ASAP!!!! 3AgNO₃ + K₃PO₄ --> Ag₃PO₄ + 3KNO₃ If you have 30 grams of AgNO₃, how many grams of KNO₃ would you have?

What naturally occurring antibodies are present in the serum of a Bombay person? How would reverse grouping of this person be affected?A) Anti-H and anti-A anti

Cconvert the signed 16 bit integer -31,394 base 10 to a 16 bit hexadecimal (remember each hexadecimal digit is 4 bits).

An electromagnetic wave propagating in seawater has an electric field whose time variation is given by E = z . 1 0 . coswt . If the electrical permittivity of w

Suppose the resource costs increase in a perfectly competitive industry. This change will result in a:a. leftward shift in the short-run supply curve for a firm

When a government provides for the public good, it: a) Creates policies that benefit individuals, rather than society as a whole. b) Ensures that discriminatio

Chester barnard felt that which of the following could help a poorly managed organization? a. informal relationships b. line managers c. top/down flow of inform

A ABCD FECG B 2 5 сл y D LL F E 6100° 5 4 120° G y = [?] 60° C

Beth Israel Hospital found out about this incident from the patient. The day after undergoing the delivery that delivered a healthy girl, Gedz held a mirror up