Replication, Transcription, and Translation Chart
Please answer
DNA Replication:
1。Template Strand: Start with this nucleotide chain.
TACCCTTGAATAAAAAATCTCTGTTTGGTCGGTATTGTTGAAATC
2。Complementary DNA Strand: Write directly below template strand.
Transcription:
3。mRNA Strand: Write the complementary mRNA strand from the DNA template strand (#1).
Translation:
4。Anticodon: Write the anticodon sequence to match the mRNA strand (#3).
5。Protein Synthesis: Write the mRNA sequence that is complementary to the anticodons. Meaning the opposite code of the anticodons (#4).
6。Amino Acid Sequence: Create the amino acid sequence from protein synthesis using 3 letter abbreviation for amino acids (#5).