estevan2020 estevan2020

15-11-2020
Mathematics

contestada

Solve for x: [3x + 12] = 18
A. x = -2, x = 10
B. X = 10, x = -10
C. X = 2, x = -2
O D. x = 2, x = -10

Respuesta :

adebating21 adebating21

15-11-2020

Answer:

D

Step-by-step explanation:

3(2) + 12 = 18

3(-10) + 12 = -18

The only answer that has two 18s solutions is D

Answer Link

Otras preguntas

Problem statement: A specialty donation allows you to give more of what patients need in just one appointment. During your donation, one part of your blood is c

secretion of endogenous corticosteroids into bloodstream is controlled bya. The hypothalamusb. The pituitary glandc. The adrenal glandsd. The kidneys

Compute Count2(CATGCCATTCGCATTGTCCCAGTGA, CCC).

The pair of structures given below represents CH3-CH3-Br-H-H and H-H-H-H-CH3-CH2Br. What is the relationship between these two structures? A. Constitutional iso

Assertion: At 0K germanium is a superconductor. Reason: At 0K` germanium offers zero resistance. A. If both the assertion and reason are true and reason is a tr

The author wrote "A New Adventure" to show that God has a plan. TrueFalse

Write the solution set of the given homogeneous system in parametric vector form.2x1 + 2x2 + 4x3 = 0-4x1 - 4x2 - 8x3 = 0-6x2 – 6x3 = 0where the solution set is

According to the filter theory of attention, attention is like a filter because it a. only lets some colors on the light spectrum through to the brain. b. allow

What is the primary difference between a LEAD School and a LEAD Provincial Conference?a) A LEAD School focuses on providing education and training at a local le

Match each of the terms with the best identifying phrase. Column A 1. 2. 3. 6. 7. 8. 9. 10. Term used to describe a person who gets inadequate amounts of sleep.