kjwalker78 kjwalker78
  • 15-08-2020
  • English
contestada

One is 250 grams. The other is 330 grams. In milligrams, what is the difference between the two weights of the animals?

Respuesta :

gantaabhish gantaabhish
  • 15-08-2020

Answer:

80000 milligrams

Explanation:

330 - 250

=> 80 grams

1 gram = 1000 milligrams

=> 80 grams = 80 x 1000 milligrams

=> 80 grams = 80000 milligrams

Answer Link

Otras preguntas

Renaissance painters valued __________ and aimed to make their works of art as close to real life as possible.
How many moles of C2H2 are required to produce 0.60 mol of H2O? Express your answer to two significant figures and include the appropriate units.
solve the enquality 2x+1>11​
magnet attracts nails but not copper vessels
add h and 6, then subtract 2 from the result​
Please help!!! A sculptor is planning to make two triangular prisms out of steel. The sculptor will use ABC for the bases of one prism and DEF for the bases of
Palestine came under British rule after what?
find the value of x and y​
RNA: CATTGGCTAACGTCGATAATCGTCGGTAC 9. Which amino acids would be found in the mutation protein? Which amino acids would be found in the mutation protein
Find all the zeroes of the polynomial x^4 − 3x^3 + 6x − 4 , if two of its zeroes are √2 and −√2 . Thanks​