brayantecg34 brayantecg34

15-05-2020
English

contestada

Melinda frequently compares herself to which of the following animals?
a puppy
a hornet
a bunny rabbit
a bear
a tiger

Respuesta :

jthompson12 jthompson12

15-05-2020

Answer:

Maybe a bear or a bunny!!!????

Explanation:

We can all jump like a bunny!

And a bear Most people eat meat and the bears can stand on their back paws!! I don't know this is weird!!!!!!!

Answer Link

adnanthegoat adnanthegoat

15-05-2020

A bunny because she got hops

Answer Link

Otras preguntas

Enzymes are typically what type of biomolecules

Vicki has a 50 inch roll of ribbon. She used 3 feet of the ribbon to wrap a gift, How many inches of ribbon does she have left?

All of the following names represent main empires of the inter-Testamental era except: Persian Grecian Egyptian Roman

The individual rhythms of polyrhythmic music are A. identical. B. independent and contrasting. C. played only once. D. created by chance.

The center has a circular pond with a diameter of 20 M what is the approximate area of the pond

1. Replicate the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’

What is an expression, in simplest form for the perimeter of a triangle which is 3m, 3m, and 3m

The Ming Dynasty became the ruling power in China in 1368. Between the years 1405 and 1433, the Ming government sponsored seven naval expeditions. The governmen

west deposited $15,000 in a savings account earning 2.5% simple interest what was the total interest earned at the end od 8 years

Which of the following correctly describes an example of how climate affected the settlement of countries in North America? A. Most of the people in the United