shantalturquiose shantalturquiose

12-09-2018
Mathematics

contestada

I realllyyy need help I feel so dumb idk why :(

I realllyyy need help I feel so dumb idk why class=

Respuesta :

robbzzz robbzzz

12-09-2018

hope it help can help... :)

Ver imagen robbzzz

Answer Link

Otras preguntas

If thermohaline circulation ceased, what might happen? Nothing; it's in the ocean. A significant change would occur in the rock cycle. A significant change wou

Dana has nine pairs of shoes. She wants to organize them in her closet so that they are placed in a row. In how many different ways can Dana arrange nine pairs

A kitchen is shaped like a rectangle with dimensions of 11 1/2 ft by 9 1/2 the floor of the room is made of square tiles with side length of 1/2ft .what is the

Which is a difference between antibodies and antigens? Antigens destroy pathogens; antibodies trigger the production of antigens. Antigens trigger the productio

Which type of attraction can be used to explain the unusually high boiling point of h2o?? 1. Ionic bonding 2. Hydrogen bonding 3. Polar covalent bonding 4. non

Normal hemoglobin DNA - cacgtggactgaggactcctc What is the normal hemoglodin acid- Normal hemoglobin A.A sequnce For figuring out RNA A binds with U C binds

Which occupation would be more likely to require emotion work as a job requirement?

Danielle plotted 3 points from the equation y = 4x on this coordinate grid. She drew a straight line through the points. Which ordered pair would also be on th

Michelle can fold 4 baskets of clothes in 54 minutes, while Ruby can fold 4 baskets of clothes in 108 minutes. How long will it take them to fold 8 baskets of c

if you want your crops to grow larger than they normally would,you may want to try adding